There are two different UPRs that each have their own specific function and activities. The UPR-specific-splicing\u2019s activities (sXBP-1) could be built in a cellular and molecular system, which acts as a cytoprotective (adaptive UPR) or leads to cell death (terminal UPR) (40). Different cell faith can occur after shifting between the abovementioned UPRs forming and sequential activities. For instance, the Ca2+<\/sup> overload could be a hot point to activate terminal UPR activation that leads to cell death (41). <\/span><\/p>\n In this study, we hypothesized that pro-inflammatory activation by LPS could be prevented by using an appropriate combination of CCIs.<\/p>\n The whole research study design and materials were divided into two main research: (I) isolation of human-tissue-derived bacteria and subsequent extraction of (wild) LPS (hLPS); and (II) investigation of hLPS-inflammation-induced responses of UPR and XBP-1 splicing. In short, the first research studies were conducted in 5 consecutive steps: 1. Clinical sampling of patients with severely burned wounds; 2. Biochemical identification, confirmation and analysis of isolated bacteria P. aeruginosa<\/i> (Figure 2); 3. Extraction of hLPS from isolated bacteria and quality control of the extraction method by using HPLC confirmation; 4. Construction of novel study design in-vivo<\/i>-animal modeling to compare wild-purified hLPS versus chemical standard LPS from Sigma-Aldrich Germany (control), without and with calcium channels inhibitors (CCIs), i.e. Dantrolene sodium CCI1 (Sigma-Aldrich, Germany) (CCI1), 2-Aminoethyl diphenyl borinate (2A-D) (CCI2), and 5. Analysis of molecular biologic experiments and evaluation of changes in the XBP-1 mRNA-gene splicing in mice\u2019s liver.<\/p>\n The whole procedure was fully explained to the subjects, and after obtaining informed consent, isolation of the samples was carried out. Patients with more than 40% severe burned wounds, and probability of infection with P<\/i>. aeruginosa<\/i> infection characteristics were selected. Samples were collected from patients from the Surgery Department of Velayat Hospital Rasht, Rasht, Iran, using sterile swabs and immediately transferred to the Stewart culture medium (Merck, Germany). Swabs were then inoculated to the BHI medium (Merck, Germany), separately cultured on cetrimide (Merck, Germany) and blood agar (Millipore, Germany), in aseptic conditions and finally incubated at 42\u00b0C for 48 hours.<\/p>\n Grown colonies in the cetrimide and blood agar with specific pigmentation were prepared on the slide for the Gram staining kit (Parsian Teb, Tehran, Iran). Additional biochemical and complementary experiments were conducted to determine bacterial identities, such as citrate, oxidase, indole, urea, and triple sugar iron agar (TSI) (Millipore, Germany).<\/p>\n Extraction of endotoxin was carried out by using a specific LPS intron purification kit based on the manufacturer\u2019s instructions. The extracted endotoxin was visualized via 12% polyacrylamide gel electrophoresis (PAGE), stained with silver nitrate, and kept at 4\u00b0C until the next use. Then, high-performance liquid chromatography (HPLC) fractionation was used to evaluate and confirm the purity of isolated hLPS versus standard control P. aeroginosa <\/i>LPS purchased from Sigma, Germany (SIGMA-Cat.no: L8643).<\/p>\n Male c57\/BL6 mice were randomly selected to be studied (six to eight weeks old\/25 \u00b1 1 grams). All animals were equally exposed to 12-12 \u00a0 \u00a0 \u00a0 <\/span>light-dark circadian cycles and had unrestricted access to water and food during the experiment. The animals were divided into five groups, and each group (n=6) was divided into three-time intervals (2, 8, and 24 hrs.) as follows: 1) <\/b>Negative control; 2) Positive control; 3) Group, which received CCI1+hLPS; 4) Group, which received CCI2+hLPS, and finally; 5) Group, which received a combination of both calcium channel inhibitors (CCI1+CCI2)+hLPS.<\/p>\n Negative control animals received sterile pyrogen-free normal saline. Animals in the positive controls group were treated with 3 mg\/kg\/intraperitoneal (IP)-injection of tunicamycin (2.5 mg\/kg) to induce ER stress artificially, and the injection of P. aeruginosa<\/i> LPS was commercially purchased from Sigma, Germany (3 mg\/kg), as proposed by Nemzek et al. (42), according to the established toxemia model, and based on previous studies (Figure 4, A). Animals in Group 3 received hLPS (3 mg\/kg, IP) +CCI1 (40 mg\/kg). Animals in Group 4 received CCI2 (1 mg\/kg) + hLPS (3 mg\/kg, IP). Finally, the last animal group (group 5) received a combination of CCI1 (40 mg\/kg) + CCI2 (1 mg\/kg) + (3 mg\/kg, IP). In all experimental study groups, the beta-actin house-keeping gene (155 bp in length) was amplified as an internal control of molecular tests.<\/p>\n Along with isolation, verification, quality controls, and immunological assay, the splicing of the XBP-1 mRNA gene was studied in the isolated liver tissue of mice. All surgical instruments were sterilized and were set DNase-RNase free\/non-pyrogen for surgical removal and separation of animal liver tissue. Small 10-mg pieces of the isolated liver were immediately frozen after aseptic transfer to the DNase-RNase free\/non-pyrogen sterile microtube.<\/p>\n The DNA and RNA of all prepared specimens were extracted using specific kits and according to the manufacturer\u2019s guidelines, and then RT-PCR was performed. Using the spectroscopic technique (NanoDrop-2000c spectrophotometers, Thermo Fisher Scientific, USA), the purity of the extracted RNA was measured. Prior to the cDNA synthesis of extracted RNAs, RNA samples were treated with a DNase specific kit (Sina Clone, Iran) to eliminate possible contamination with DNA. After treatment with a DNase-specific kit, the samples were subjected to RT-PCR (Thermo Fisher Scientific, USA). For PCR, a sensitive and specific primer pair was used for test and control groups. XBP-1 forward primer: 5`GAACCAGGAGTTAAGAACACG3`, and reverse primer: 5`AGGCAACAGTGTCAGAGTCC3` (size of PCR product: unspliced uXBP-1=205 bp and spliced sXBP-1=179 bp) as described (43), and \u03b2-actin housekeeping primers were obtained from Cinna gen, Iran.<\/p>\n The statistics of our descriptive results were reported at three-time intervals at 2, 8, and 24 hours after each injection using the number of splicing in animals\u2019 livers compared to the total number of animals. The results of the experiment were analyzed by using the IBM-SPSS software version 16 via \u03c72 statistic tests at the significant level (p<\/i>< 0.05). All data were expressed as mean \u00b1 standard deviation.<\/p>\n Figure 1.<\/strong> Study hypothesis over LUCOGS. In our previous research study, we showed that hLPS could increase cytokine release (8). However, in the present study, we investigated hLPS effects on LUCOGS and focused on the UPR machinery and correlated signal transduction inducing gene splicing in mice\u2019s hepatic tissue (Figure 1).<\/p>\n The isolated bacteria from human burned wounds were confirmed as P. aeruginosa<\/i> sort, based on culture and biochemical identification observations and a positive oxidase test (Figure 2, A-H). The PAGE electrophoresis data show a different concentration of purified hLPS. The same samples with an efficient concentration were pooled together and applied for the next steps of the tests.<\/p>\n Figure 2.<\/strong> Isolated bacterium determination. In addition, Figure 2 depicts how we isolated targeted bacteria and hLPS from a human wound. In short, after obtaining informed consent from the patients, burned wound bacteria were isolated and cultured on the blood agar. Cultured bacteria from specimens grown well in enriched, specific, and differential media (Figure 2, A-H).<\/p>\n Figure 3.<\/strong> Extracted hLPS validation. After isolation and validation of human targeted bacteria sort via biochemical tests, the hLPS biologic compound was purified, and its quality and efficacy were compared to standard chemical LPS using HPLC (Figure 3, A and B). We observed that our isolated purified hLPS had proper purity as standard LPS checked by 12% PAGE silver staining. Eventually, all hLPS samples were aliquoted and stocked at -70\u00b0C for further supplementary tests (final concentration 3mg\/ml).<\/p>\n The molecular results acquired from whole experiments after confirmation of splicing and non-splicing pattern were represented as follows:<\/p>\nMETHODS<\/h2>\n
The Clinical Sampling of Patients with Burned Wounds<\/h3>\n
Biochemical Identification of Bacteria Isolated from Patients<\/h3>\n
LPS Extraction<\/h3>\n
Animal Modeling and Molecular Biologic Assays<\/h3>\n
Molecular Experiments<\/h3>\n
Statistical Analysis<\/h3>\n
RESULTS<\/h2>\n
![\"\"](\"https:\/\/www.klimikdergisi.org\/wp-content\/uploads\/2021\/12\/KD.C34.S3_3682_Figure1.png\")
<\/a>
There are different inflammatory and antioxidant mechanisms available in the hepatic cell during exposure to LPS. Ca+2 released by inositol three phosphate receptor (IP3R) increases mitochondrial activity during endoplasmic reticulum (ER) stress to revert energy imbalance, but if it fails, the cell will die as a result of the mitochondrial apoptotic cascade. Ca+2 released from ryanodine receptors on the endoplasmic reticulum could increase the Ca+2 overload pool for IP-3 receptors and lead to an extra inflammatory response.
ROS:<\/strong> Reactive Oxygen Species, UPR:<\/strong> Unfolded Protein Response, LPS:<\/strong> Lipopolysaccharide, NOX:<\/strong> NO and NO2, ROS:<\/strong> Reactive Oxygen Species.<\/p><\/div>\nQuality Control and Assurance of Human LPS Isolated from Burned Wound<\/h3>\n
<\/a>
Results of the isolated bacteria identification of patients based on culture, microscopic examination, and biochemical test results.
A:<\/strong> Urease negative test, B:<\/strong> Positive Simon citrate test, C:<\/strong> Sulfur indole motility (SIM) test, D:<\/strong> Triple sugar iron agar (TSI) test (alkaline\/alkaline), E:<\/strong> Positive cultivation on Blood Agar medium, F:<\/strong> Positive cultivation and production of specific pigment in cetrimide agar,
G:<\/strong> Gram negative staining in the microscopic examination; and
H:<\/strong> Positive oxidase test.<\/p><\/div>\n<\/a>
I)<\/strong> hLPS poly acrylamide gel electrophoresis (PAGE). Lane 1: Molecular weight ladder (3.5-200kDa), Lanes 2, 3, 5, and 7: Purified hLPS of P. aeruginosa<\/i> isolated from clinical samples, Lane 4: Standard commercial control of P. aeruginosa<\/i> LPS (SIGMA-Cat: L8643).
II)<\/strong> HPLC fractionation of purified hLPS compared to the standard commercial control of P. aeruginosa<\/i> LPS (SIGMA-Cat: L8643). Chromatogram A indicates purified hLPS from isolated clinical samples, and chromatogram B is the standard commercial control of P. aeruginosa<\/i> LPS (SIGMA-Cat: L8643). HPLC: High-Performance Liquid Chromatography, hLPS: The LPS extracted from P. aeruginosa<\/i>.<\/p><\/div>\nMolecular Analysis<\/h3>\n
Two-hour post-injection<\/i><\/b><\/h4>\n